October 3, 2022

Identification of a novel KIR3DL3*064 allele by cDNA cloning and sequencing

Identification of cellular inhibitors in opposition to Chikungunya virus replication by a cDNA expression cloning blended with MinION sequencing


  • cDNA expression cloning has been confirmed to be a powerful technique throughout the search for cellular components that administration virus replication. On this look at, cDNA library screening using a pool of cDNA derived from interferon-treated human cells was blended with the MinION sequencer to determine cellular genes inhibiting Chikungunya virus (CHIKV) replication.


  • Downside an an infection of CHIKV to Vero cells transduced with the cDNA library produced virus-resistant cells. Then, the MinION sequence of cDNAs extracted from the surviving cells revealed that the open finding out frames of TOM7, S100A16, N-terminally truncated kind of ECI1 (ECI1ΔN59), and RPL29 have been inserted in a number of the cells.


  • Importantly, the transient expression of TOM7, S100A16, and ECI1ΔN59 was found to inhibit the replication of CHIKV in Huh7 cells, indicating that these cellular components have been doubtlessly anti-CHIKV molecules.


  • Thus, our look at demonstrated that cDNA expression cloning blended with the MinION sequencer allowed a quick and full detection of cellular inhibitors in opposition to CHIKV.


XPO6 Antibody

46712-100ul 100ul
EUR 252

XPO6 Antibody

DF12799 200ul
EUR 304
Description: XPO6 Antibody detects endogenous levels of XPO6.

XPO6 antibody

70R-21344 50 ul
EUR 435
Description: Rabbit polyclonal XPO6 antibody

XPO6 cloning plasmid

CSB-CL842747HU1-10ug 10ug
EUR 814
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2514
  • Sequence: atggcgtcagttaacggcagcagccagaactgtgtctcgggtcaggagcgcggccggctgggggtcctggccatgtcctgcatcaatgaactcatgtccaagaactgtgtgcctatggaatttgaggagtatttactgcgtatgttccagcagactttctacctcctgcagaaaa
  • Show more
Description: A cloning plasmid for the XPO6 gene.

XPO6 cloning plasmid

CSB-CL842747HU2-10ug 10ug
EUR 1202
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3378
  • Sequence: atggcatctgaagaagcctctctcagggcattggaaagtctgatgacagaattttttcacgattgtacaaccaatgaaagaaaacgtgagatagaggagcttcttaataactttgcccagcaaataggagcctggagattctgcctgtactttctctccagcactaggaatgact
  • Show more
Description: A cloning plasmid for the XPO6 gene.

Anti-XPO6 antibody

STJ13100475 100 µl
EUR 427

Anti-XPO6 antibody

STJ112437 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

XPO6 Rabbit pAb

A10401-100ul 100 ul
EUR 308

XPO6 Rabbit pAb

A10401-200ul 200 ul
EUR 459

XPO6 Rabbit pAb

A10401-20ul 20 ul
EUR 183

XPO6 Rabbit pAb

A10401-50ul 50 ul
EUR 223

anti- XPO6 antibody

FNab09550 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:10-1:100
  • IP: 1:200-1:1000
  • Immunogen: exportin 6
  • Uniprot ID: Q96QU8
  • Gene ID: 23214
  • Research Area: Signal Transduction
Description: Antibody raised against XPO6

XPO6 Conjugated Antibody

C46712 100ul
EUR 397

XPO6 Blocking Peptide

DF12799-BP 1mg
EUR 195

Anti-XPO6 antibody

PAab09550 100 ug
EUR 355

Exportin-6 (XPO6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 6 (XPO6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse XPO6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human XPO6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Exportin-6 (XPO6) Antibody

abx037309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx239550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


EF004323 96 Tests
EUR 689

Human Exportin 6 (XPO6) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

XPO6 ORF Vector (Human) (pORF)

ORF014966 1.0 ug DNA
EUR 354

XPO6 ORF Vector (Human) (pORF)

ORF011649 1.0 ug DNA
EUR 95

Xpo6 ORF Vector (Mouse) (pORF)

ORF061968 1.0 ug DNA
EUR 506

Xpo6 ORF Vector (Rat) (pORF)

ORF079217 1.0 ug DNA
EUR 506

Human Exportin-6 (XPO6) ELISA Kit

abx384332-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Exportin 6(XPO6)ELISA Kit

QY-E01489 96T
EUR 361

Mouse Exportin- 6, Xpo6 ELISA KIT

ELI-51533m 96 Tests
EUR 865

Human Exportin- 6, XPO6 ELISA KIT

ELI-17963h 96 Tests
EUR 824

Xpo6 sgRNA CRISPR Lentivector set (Rat)

K6323501 3 x 1.0 ug
EUR 339

Xpo6 sgRNA CRISPR Lentivector set (Mouse)

K4963501 3 x 1.0 ug
EUR 339

XPO6 sgRNA CRISPR Lentivector set (Human)

K2650901 3 x 1.0 ug
EUR 339

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Novo? cDNA Kit

EUR 354

Novo? cDNA Kit

EUR 267

Evo? cDNA Supermix

EUR 381

Evo? cDNA Supermix

EUR 267

Novo? cDNA Supermix

EUR 441

Novo? cDNA Supermix

EUR 289

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6323502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6323503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6323504 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4963502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4963503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4963504 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2650902 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2650903 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2650904 1.0 ug DNA
EUR 154

XPO6 Protein Vector (Rat) (pPB-C-His)

PV316866 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPB-N-His)

PV316867 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPM-C-HA)

PV316868 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPM-C-His)

PV316869 500 ng
EUR 1191

XPO6 Protein Vector (Human) (pPB-C-His)

PV046593 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPB-N-His)

PV046594 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPM-C-HA)

PV046595 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPM-C-His)

PV046596 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPB-C-His)

PV059861 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPB-N-His)

PV059862 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPM-C-HA)

PV059863 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPM-C-His)

PV059864 500 ng
EUR 481

XPO6 Protein Vector (Mouse) (pPB-C-His)

PV247870 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPB-N-His)

PV247871 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPM-C-HA)

PV247872 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPM-C-His)

PV247873 500 ng
EUR 1065

XPO6 3'UTR GFP Stable Cell Line

TU078606 1.0 ml
EUR 1394

Xpo6 3'UTR Luciferase Stable Cell Line

TU223481 1.0 ml Ask for price

Xpo6 3'UTR GFP Stable Cell Line

TU172394 1.0 ml Ask for price

Xpo6 3'UTR GFP Stable Cell Line

TU273481 1.0 ml Ask for price

XPO6 3'UTR Luciferase Stable Cell Line

TU028606 1.0 ml
EUR 1394

Xpo6 3'UTR Luciferase Stable Cell Line

TU122394 1.0 ml Ask for price

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309


Identification of a novel KIR3DL3*064 allele by cDNA cloning and sequencing

Aim: To report on a novel KIR3DL3 allele acknowledged in a southern Han Chinese language language explicit particular person.


Methods: Peripheral blood sample was collected from a voluntary blood donor with inconclusive final result by KIR3DL3 sequence-based typing (SBT). Complete mRNA was extracted and subjected to reverse transcription to amass KIR3DL3 cDNA, which was then amplified by PCR with a pair of KIR3DL3-specific primers. The product was subjected to cDNA cloning and sequencing.


Outcomes: cDNA cloning and sequencing have acknowledged a wide-type KIR3DL3*00802 allele and a novel KIR3DL3*064 allele. The latter differed from KIR3DL3*00601 by a missense variant at codon 374[c.1184 C>T (p.Thr374Ile)] in exon 9. The novel KIR3DL3 allele has been formally assigned by the KIR subcommittee of World Properly being Group Nomenclature Committee for components of HLA system.


Conclusion: cDNA cloning and sequencing is also used to inform aside inconclusive ends in KIR3DL3 SBT with a function to determine novel KIR alleles.


Apple Russet Ring and Apple Inexperienced Crinkle Sicknesses: Achievement of Koch’s Postulates by Virome Analysis, Amplification of Full-Dimension cDNA of Viral Genomes, in vitro Transcription of Infectious Viral RNAs, and Duplicate of Indicators on Fruits of Apple Bushes Inoculated With Viral RNAs



Apple russet ring and apple inexperienced crinkle are graft-transmitted sicknesses first reported larger than 60 years previously, nevertheless at present, no affiliation between a specific virus (variant) and the sickness has been clearly demonstrated.


On this look at, we carried out the subsequent assortment of experiments to determine the causal viruses (variants) of these apple sicknesses; (1) full analysis by next-generation sequencing of all viruses in each apple tree affected with russet ring or inexperienced crinkle sickness,


(2) amplification of full-length genomic cDNA of viruses using primers containing the T3 promoter and the in vitro transcription of infectious viral RNAs, (3) inoculation of viral RNA transcripts to every herbaceous and apple crops, (4) analysis of sequence variants of viruses present in contaminated crops, (5) back-inoculation of sequence variants of candidate viruses to apple seedlings blended with the virus-induced flowering know-how using the apple latent spherical virus vector to breed the symptom on the fruit as shortly as doable, and


(6) duplicate of indicators on the fruits of apple timber inoculated with sequence variants and the re-isolation of each virus variant from apples exhibiting fruit indicators.


The outcomes confirmed that one in all many sequence variants of the apple chlorotic leaf spot virus causes a attribute ring-shaped rust on the fruits of contaminated apple timber and {{that a}} sequence variant of the apple stem pitting virus possibly causes inexperienced crinkle indicators on an contaminated apple fruit.


Thus, we’ve got been able to fulfill Koch’s postulates to point out the viral etiology of every the apple russet ring and inexperienced crinkle sicknesses. We moreover recommend an experimental system which will present whether or not or not a virus current in diseased tissues is the pathogen accountable for the sicknesses when the etiology is undetermined.


Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-48Tests 48 Tests
EUR 521
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-96Tests 96 Tests
EUR 723
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-48Tests 48 Tests
EUR 557
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-96Tests 96 Tests
EUR 775
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
EUR 517
  • Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
EUR 673
  • Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
EUR 549
  • Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
EUR 718
  • Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4
AMR09390G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PLTP Antibody
32933-100ul 100ul
EUR 252
PLTP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
PLTP Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PLTP Antibody
DF7426 200ul
EUR 304
Description: PLTP Antibody detects endogenous levels of total PLTP.
PLTP Antibody
ABD7426 100 ug
EUR 438
PLTP Antibody
EUR 327
PLTP Antibody
EUR 146
YF-PA24404 50 ul
EUR 334
Description: Mouse polyclonal to PLTP
YF-PA13839 50 ul
EUR 363
Description: Mouse polyclonal to PLTP
YF-PA13840 100 ug
EUR 403
Description: Rabbit polyclonal to PLTP
PVT12200 2 ug
EUR 391
PLTP antibody
70R-10288 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PLTP antibody
PLTP antibody
70R-11938 100 ug
EUR 418
Description: Rabbit polyclonal PLTP antibody
Recombinant Phospholipid Transfer Protein (PLTP)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55065
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 10.1
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli
Recombinant Phospholipid Transfer Protein (PLTP)
  • EUR 469.15
  • EUR 229.00
  • EUR 1484.32
  • EUR 561.44
  • EUR 1022.88
  • EUR 377.00
  • EUR 3560.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: E9PSP1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli
PLTP Polyclonal Antibody
ES10007-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PLTP Polyclonal Antibody
ES10007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-PLTP Antibody
PA2228 100ug/vial
EUR 334
PLTP Rabbit pAb
A5628-100ul 100 ul
EUR 308
PLTP Rabbit pAb
A5628-200ul 200 ul
EUR 459
PLTP Rabbit pAb
A5628-20ul 20 ul
EUR 183
PLTP Rabbit pAb
A5628-50ul 50 ul
EUR 223
PLTP Polyclonal Antibody
A53320 100 µg
EUR 570.55
Description: The best epigenetics products
PLTP Polyclonal Antibody
ABP59951-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
PLTP Polyclonal Antibody
ABP59951-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
PLTP Polyclonal Antibody
ABP59951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
Anti-PLTP antibody
STJ27595 100 µl
EUR 277
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.
Anti-PLTP antibody
STJ191165 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLTP
Polyclonal PLTP Antibody
AMR09385G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
Polyclonal PLTP Antibody
AMR09386G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
Polyclonal PLTP Antibody
AMR09387G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:
PLTP cloning plasmid
CSB-CL018212HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.
PLTP cloning plasmid
CSB-CL018212HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.
PLTP Conjugated Antibody
C32933 100ul
EUR 397
PLTP Blocking Peptide
DF7426-BP 1mg
EUR 195
PLTP Blocking Peptide
EUR 153
PLTP Blocking Peptide
33R-10824 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938
PLTP Blocking Peptide
33R-6693 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP)
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP)
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
ESP0138 96Tests
EUR 521
EMKP0138 96Tests
EUR 521
EMP0138 96Tests
EUR 521
Porcine PLTP ELISA Kit
EPP0138 96Tests
EUR 521
ERP0138 96Tests
EUR 521
ERTP0138 96Tests
EUR 521
EBP0138 96Tests
EUR 521
Chicken PLTP ELISA Kit
ECKP0138 96Tests
EUR 521
ECP0138 96Tests
EUR 521
EHP0138 96Tests
EUR 521
Anserini PLTP ELISA Kit
EAP0138 96Tests
EUR 521
EGTP0138 96Tests
EUR 521
Human PLTP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PLTP shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PLTP Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PLTP Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PLTP Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EF007098 96 Tests
EUR 689
PLTP Recombinant Protein (Mouse)
RP162998 100 ug Ask for price
Anti-PLTP (2F3-G4)
YF-MA10707 100 ug
EUR 363
Description: Mouse monoclonal to PLTP
PLTP Recombinant Protein (Human)
RP023854 100 ug Ask for price
PLTP Recombinant Protein (Human)
RP023857 100 ug Ask for price
PLTP Recombinant Protein (Rat)
RP221072 100 ug Ask for price
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.


Leave a Reply

Your email address will not be published. Required fields are marked *