September 25, 2022

Extraction of high-quality tissue-specific RNA from London aircraft timber

elevagemrmagoo

Extraction of high-quality tissue-specific RNA from London plane timber (Platanusacerifolia), permitting the event of a female inflorescence cDNA library

 

  • The London plane tree (PlatanusacerifoliaWilld.) has worldwide significance as an metropolis landscaping tree and is the subject of genetic-improvement functions for productive sterility, sickness and/or insect resistance. Molecular analysis strategies are important to such functions, nonetheless may be impeded by explicit difficulties encountered all through nucleic acid isolation.

 

  • An in depth RNA isolation and purification protocol, based on established cetyltrimethyl-ammonium bromide (CTAB) extraction strategies blended with additional purification steps using butanol and the ionic detergent CTAB, which overcomes these points inside the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are certain to soluble polyvinylpyrrolidone after which separated out by means of LiCl precipitation of the RNA.

 

  • Subsequently, protein- and carbohydrate-contaminants are eradicated by chloroform partitioning adopted by LiCl-mediated precipitation. The following isolates of RNA have been found to be of sufficient top quality for worthwhile use in reverse transcription PCR analysis.

 

  • Furthermore, RNA isolates from female inflorescences have been used for the event of a cDNA library. This library was found to incorporate quite a lot of full-length cDNA clones of MADS-box genes, in line with the library being guide of inflorescence expression profiles.
elevagemrmagoo
elevagemrmagoo

LILRB2 Antibody

1-CSB-PA943186
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody

35791-100ul 100ul
EUR 252

LILRB2 siRNA

20-abx922560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LILRB2 Antibody

ABD9604 100 ug
EUR 438

LILRB2 Antibody

DF9604 200ul
EUR 304
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

anti-LILRB2

YF-PA16864 50 ul
EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16865 50 ug
EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16866 100 ug
EUR 403
Description: Rabbit polyclonal to LILRB2

LILRB2 cloning plasmid

CSB-CL839793HU-10ug 10ug
EUR 612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc
  • Show more
Description: A cloning plasmid for the LILRB2 gene.

Anti-LILRB2 antibody

STJ112174 100 µl
EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody

STJ114050 100 µl
EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

LILRB2 Rabbit pAb

A12157-100ul 100 ul
EUR 308

LILRB2 Rabbit pAb

A12157-200ul 200 ul
EUR 459

LILRB2 Rabbit pAb

A12157-20ul 20 ul
EUR 183

LILRB2 Rabbit pAb

A12157-50ul 50 ul
EUR 223

LILRB2 Rabbit pAb

A10135-100ul 100 ul
EUR 308

LILRB2 Rabbit pAb

A10135-200ul 200 ul
EUR 459

LILRB2 Rabbit pAb

A10135-20ul 20 ul
EUR 183

LILRB2 Rabbit pAb

A10135-50ul 50 ul
EUR 223

LILRB2 Conjugated Antibody

C35791 100ul
EUR 397

LILRB2 Blocking Peptide

DF9604-BP 1mg
EUR 195

pDONR223-LILRB2 Plasmid

PVTB00316 2 ug
EUR 356

Anti-LILRB2 (1D4)

YF-MA17235 100 ug
EUR 363
Description: Mouse monoclonal to LILRB2

LILRB2 Recombinant Protein

96-515 0.1 mg
EUR 516.5
Description: Leukocyte immunoglobulin-like receptor subfamily B member 2 (LILRB2) is also known as CD85 antigen-like family member D (CD85d), Immunoglobulin-like transcript 4 (ILT-4), Monocyte / macrophage immunoglobulin-like receptor 10 (MIR-10), which is a member of the the subfamily B class of LIR receptors. LILRB2 is receptor for class I MHC antigens. LILRB2 recognizes a broad spectrum of HLA-A, HLA-B, HLA-C and HLA-G alleles. LILRB2 competes with CD8A for binding to class I MHC antigens. LILRB2 / CD85d inhibits FCGR1A-mediated phosphorylation of cellular proteins and mobilization of intracellular calcium ions.

LILRB2 Recombinant Protein

96-915 0.1 mg
EUR 516.5
Description: Leukocyte immunoglobulin-like receptor subfamily B member 2 (LILRB2) is also known as CD85 antigen-like family member D (CD85d), Immunoglobulin-like transcript 4 (ILT-4), Monocyte / macrophage immunoglobulin-like receptor 10 (MIR-10), which is a member of the the subfamily B class of LIR receptors. LILRB2 is receptor for class I MHC antigens. LILRB2 recognizes a broad spectrum of HLA-A, HLA-B, HLA-C and HLA-G alleles. LILRB2 competes with CD8A for binding to class I MHC antigens. LILRB2 / CD85d inhibits FCGR1A-mediated phosphorylation of cellular proteins and mobilization of intracellular calcium ions.

LILRB2 Recombinant Protein

91-439 0.05 mg
EUR 448.25
Description: Members of the immunoglobulin-like transcript (ILT) family are activating and inhibitory immunoreceptors whose genes are located same locus that encodes killer cell Ig-like receptors (KIR). Leukocyte Immunoglobulin-Like Receptor Subfamily B Member 2 (LIR-2) is a type I transmembrane protein. LIR-2 is expressed primarily on monocytes and dendritic cells (DC). Human LIR-2 is produced as a 598 amino acino acid precursor including a 21 aa signal sequence, a 440 aa extracellular domain (ECD), a 21 aa transmenbrane segment, and a 116 aa cytoplasmic domain. LIR-2 binds to Classical MHCI proteins. Ligation of LIR-2 incluces Tyr phosphorylation within its cytoplasmic ITIMs, a requirement for association with SHP-1. LIR-2 mediates tolerogenic DC-induced CD4+ T cell energy in vitro and in vivo.

LILRB2 Antibody, HRP conjugated

1-CSB-PA013000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated

1-CSB-PA013000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated

1-CSB-PA013000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LILRB2 shRNA Plasmid

20-abx956969
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LILRB2 Polyclonal Conjugated Antibody

C41960 100ul
EUR 397

Human LILRB2 ELISA KIT

ELI-27802h 96 Tests
EUR 824

LILRB2 ELISA KIT|Human

EF006426 96 Tests
EUR 689

Human LILRB2 ELISA Kit

ELA-E7745h 96 Tests
EUR 824

LILRB2 Recombinant Protein (Human)

RP017797 100 ug Ask for price

LILRB2 ELISA Kit (Human) (OKEH01827)

OKEH01827 96 Wells
EUR 727
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

LILRB2 ORF Vector (Human) (pORF)

ORF005933 1.0 ug DNA
EUR 95

Human CellExp? LILRB2, human recombinant

P1147-10
EUR 131

Human CellExp? LILRB2, human recombinant

P1147-50
EUR 403

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

4-RPB153Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N423
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

Recombinant Human LILRB2/CD85d/ILT4 Protein

RP00262 10 μg
EUR 149

Polyclonal LILRB2 antibody - C-terminal region

APR01570G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)

K1215401 3 x 1.0 ug
EUR 339

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1215402 1.0 ug DNA
EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1215403 1.0 ug DNA
EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1215404 1.0 ug DNA
EUR 154

LILRB2 Protein Vector (Human) (pPB-C-His)

PV023729 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPB-N-His)

PV023730 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPM-C-HA)

PV023731 500 ng
EUR 329

LILRB2 Protein Vector (Human) (pPM-C-His)

PV023732 500 ng
EUR 329

LILRB2 3'UTR GFP Stable Cell Line

TU062462 1.0 ml
EUR 1394

LILRB2 3'UTR Luciferase Stable Cell Line

TU012462 1.0 ml
EUR 1394

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse)

4-PAB153Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC

4-PAB153Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAB153Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Biotin.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Cy3

4-PAB153Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Cy3.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), FITC

4-PAB153Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with FITC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), HRP

4-PAB153Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with HRP.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), PE

4-PAB153Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with PE.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

Evo™ cDNA Kit

M1164-100 Ask for price

Evo™ cDNA Kit

M1164-25 Ask for price

Novo? Transcriptome cDNA Kit

M1167-100
EUR 952

Novo? Transcriptome cDNA Kit

M1167-25
EUR 441

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Transcriptome analysis of leaf tissue from Bermudagrass (Cynodondactylon) using a normalised cDNA library

 

A normalised cDNA library was constructed from Bermudagrass to attain notion into the transcriptome of Cynodondactylon L. A whole of 15 588 high-top quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Evaluation Gene Indices clustering devices to offer a unigene set.

 

A whole of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation course of was environment friendly. A giant-scale comparative genomic analysis of the unigenes was carried out using publicly obtainable devices, paying homage to BLAST, InterProScan and Gene Ontology. The unigenes have been moreover subjected to a search for EST-derived simple sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), which can be useful as DNA markers.

 

Although the candidate EST-SSRs and CISPs found inside the present look at must be empirically examined, they’re anticipated to be useful as DNA markers for lots of capabilities, along with comparative genomic analysis of grass species, by benefit of their very important similarities to EST sequences from completely different grasses. Thus, knowledge of Cynodon ESTs will empower turfgrass evaluation by providing homologues for genes that are thought to confer very important options in several crops.

 

Prolonged-read cDNA Sequencing Permits a ‘Gene-Like’ Transcript Annotation of Transposable Components

 

  • Transcript-based annotations of genes facilitate every genome-wide analyses and detailed single locus evaluation. In distinction, transposable issue (TE) annotations are rudimentary, consisting of data solely on TE location and kind. The repetitiveness and restricted annotation of TEs prevents the facility to inform aside between doubtlessly helpful expressed elements and degraded copies.

 

  • To boost genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in quite a lot of layers of TE repression. These uniquely-mapping transcripts have been used to ascertain the set of TEs able to generate polyadenylated RNAs and create a model new transcript-based annotation of TEs that we now have now layered upon the current high-quality neighborhood regular annotation.

 

  • We used this annotation to chop again the bioinformatic complexity associated to multi-mapping reads from short-read RNA-seq experiments, and we current that this enchancment is expanded in a TE-rich genome paying homage to maize. Our TE annotation moreover permits the testing of explicit standing hypotheses inside the TE self-discipline.

 

  • We show that incorrect TE splicing does not set off small RNA manufacturing, and the cell further strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work provides a model new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to chop again the bioinformatic complexity associated to repetitive TEs in any organism.

 

GTPBP8 siRNA
20-abx918915
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GTPBP8 siRNA
20-abx902374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
Anti-GTPBP8 antibody
STJ118642 100 µl
EUR 277
GTPBP8 Polyclonal Antibody
29768-100ul 100ul
EUR 252
GTPBP8 Polyclonal Antibody
29768-50ul 50ul
EUR 187
GTPBP8 Rabbit pAb
A16189-100ul 100 ul
EUR 308
GTPBP8 Rabbit pAb
A16189-200ul 200 ul
EUR 459
GTPBP8 Rabbit pAb
A16189-20ul 20 ul
EUR 183
GTPBP8 Rabbit pAb
A16189-50ul 50 ul
EUR 223
Rat GTPBP8 shRNA Plasmid
20-abx990090
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GTPBP8 shRNA Plasmid
20-abx975375
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GTPBP8 shRNA Plasmid
20-abx959177
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GTPBP8 Polyclonal Conjugated Antibody
C29768 100ul
EUR 397
GTPBP8 Recombinant Protein (Rat)
RP203999 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014239 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014242 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140480 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140483 100 ug Ask for price
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828 1.0 ug DNA
EUR 506
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829 1.0 ug DNA
EUR 506
GTPBP8 ORF Vector (Human) (pORF)
ORF004747 1.0 ug DNA
EUR 95
GTPBP8 ORF Vector (Human) (pORF)
ORF004748 1.0 ug DNA
EUR 95
Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001 1.0 ug DNA
EUR 506
GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501 3 x 1.0 ug
EUR 339
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501 3 x 1.0 ug
EUR 339
Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901 3 x 1.0 ug
EUR 339
cDNA Synthesis SuperMix
20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Novo? cDNA Kit
M1165-100
EUR 354
Novo? cDNA Kit
M1165-25
EUR 267
Evo? cDNA Supermix
M1168-100
EUR 381
Evo? cDNA Supermix
M1168-25
EUR 267
Novo? cDNA Supermix
M1169-100
EUR 441
Novo? cDNA Supermix
M1169-25
EUR 289
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904 1.0 ug DNA
EUR 154
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018985 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018986 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018987 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018988 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018989 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018990 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018991 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018992 500 ng
EUR 329
GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187310 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187311 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187312 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187313 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187314 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187315 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187316 500 ng
EUR 603
GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187317 500 ng
EUR 603
GTPBP8 3'UTR GFP Stable Cell Line
TU059450 1.0 ml
EUR 1394
GTPBP8 3'UTR Luciferase Stable Cell Line
TU009450 1.0 ml
EUR 1394
Gtpbp8 3'UTR GFP Stable Cell Line
TU255567 1.0 ml Ask for price
Gtpbp8 3'UTR Luciferase Stable Cell Line
TU205567 1.0 ml Ask for price
Gtpbp8 3'UTR GFP Stable Cell Line
TU159227 1.0 ml Ask for price
Gtpbp8 3'UTR Luciferase Stable Cell Line
TU109227 1.0 ml Ask for price
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309
Evo™ cDNA Kit
M1164-100 Ask for price
Evo™ cDNA Kit
M1164-25 Ask for price
Novo? Transcriptome cDNA Kit
M1167-100
EUR 952
Novo? Transcriptome cDNA Kit
M1167-25
EUR 441
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.