October 31, 2020

Extraction of high-quality tissue-specific RNA from London aircraft timber


Extraction of high-quality tissue-specific RNA from London plane timber (Platanusacerifolia), permitting the event of a female inflorescence cDNA library


  • The London plane tree (PlatanusacerifoliaWilld.) has worldwide significance as an metropolis landscaping tree and is the subject of genetic-improvement functions for productive sterility, sickness and/or insect resistance. Molecular analysis strategies are important to such functions, nonetheless may be impeded by explicit difficulties encountered all through nucleic acid isolation.


  • An in depth RNA isolation and purification protocol, based on established cetyltrimethyl-ammonium bromide (CTAB) extraction strategies blended with additional purification steps using butanol and the ionic detergent CTAB, which overcomes these points inside the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are certain to soluble polyvinylpyrrolidone after which separated out by means of LiCl precipitation of the RNA.


  • Subsequently, protein- and carbohydrate-contaminants are eradicated by chloroform partitioning adopted by LiCl-mediated precipitation. The following isolates of RNA have been found to be of sufficient top quality for worthwhile use in reverse transcription PCR analysis.


  • Furthermore, RNA isolates from female inflorescences have been used for the event of a cDNA library. This library was found to incorporate quite a lot of full-length cDNA clones of MADS-box genes, in line with the library being guide of inflorescence expression profiles.

LILRB2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody

DF9604 200ul
EUR 304.00
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

LILRB2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LILRB2 Antibody

ABD9604 100 ug
EUR 438.00


YF-PA16864 50 ul
EUR 363.00
Description: Mouse polyclonal to LILRB2


YF-PA16865 50 ug
EUR 363.00
Description: Mouse polyclonal to LILRB2


YF-PA16866 100 ug
EUR 403.00
Description: Rabbit polyclonal to LILRB2

LILRB2 Rabbit pAb

A10135-100ul 100 ul
EUR 308.00

LILRB2 Rabbit pAb

A10135-200ul 200 ul
EUR 459.00

LILRB2 Rabbit pAb

A10135-20ul 20 ul
EUR 183.00

LILRB2 Rabbit pAb

A10135-50ul 50 ul
EUR 223.00

LILRB2 Rabbit pAb

A12157-100ul 100 ul
EUR 308.00

LILRB2 Rabbit pAb

A12157-200ul 200 ul
EUR 459.00

LILRB2 Rabbit pAb

A12157-20ul 20 ul
EUR 183.00

LILRB2 Rabbit pAb

A12157-50ul 50 ul
EUR 223.00

LILRB2 Blocking Peptide

DF9604-BP 1mg
EUR 195.00

LILRB2 Conjugated Antibody

C35791 100ul
EUR 397.00

LILRB2 cloning plasmid

CSB-CL839793HU-10ug 10ug
EUR 612.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc
  • Show more
Description: A cloning plasmid for the LILRB2 gene.

pDONR223-LILRB2 Plasmid

PVTB00316 2 ug
EUR 356.00

Anti-LILRB2 antibody

STJ112174 100 µl
EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody

STJ114050 100 µl
EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 (1D4)

YF-MA17235 100 ug
EUR 363.00
Description: Mouse monoclonal to LILRB2


ELI-27802h 96 Tests
EUR 824.00


ELA-E7745h 96 Tests
EUR 824.00


EF006426 96 Tests
EUR 689.00

LILRB2 Polyclonal Conjugated Antibody

C41960 100ul
EUR 397.00

LILRB2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LILRB2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

LILRB2 Recombinant Protein (Human)

RP017797 100 ug Ask for price

Human CellExp? LILRB2, human recombinant

EUR 131.00

Human CellExp? LILRB2, human recombinant

EUR 403.00

LILRB2 ORF Vector (Human) (pORF)

ORF005933 1.0 ug DNA
EUR 95.00

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8N423
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294.00

Evo? cDNA Kit

EUR 234.00

Novo? cDNA Kit

EUR 354.00

Novo? cDNA Kit

EUR 267.00

Evo? cDNA Supermix

EUR 381.00

Evo? cDNA Supermix

EUR 267.00

Novo? cDNA Supermix

EUR 441.00

Novo? cDNA Supermix

EUR 289.00

Polyclonal LILRB2 antibody - C-terminal region

APR01570G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)

K1215401 3 x 1.0 ug
EUR 339.00

Recombinant Human LILRB2/CD85d/ILT4 Protein

RP00262 10 μg
EUR 149.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1215402 1.0 ug DNA
EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1215403 1.0 ug DNA
EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1215404 1.0 ug DNA
EUR 154.00

LILRB2 Protein Vector (Human) (pPB-C-His)

PV023729 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPB-N-His)

PV023730 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-HA)

PV023731 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-His)

PV023732 500 ng
EUR 329.00

LILRB2 3'UTR GFP Stable Cell Line

TU062462 1.0 ml
EUR 1394.00

LILRB2 3'UTR Luciferase Stable Cell Line

TU012462 1.0 ml
EUR 1394.00

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106.00

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169.00

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309.00

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445.00

Novo? Transcriptome cDNA Kit

EUR 952.00

Novo? Transcriptome cDNA Kit

EUR 441.00

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Biotin.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Cy3.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with FITC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with HRP.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with PE.

Human LILRB2 Protein (Gln 22-Val 461) [Fc]

VAng-1888Lsx-100g 100 µg
EUR 765.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [Fc]

VAng-1888Lsx-1mg 1 mg
EUR 4174.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]

VAng-1889Lsx-100g 100 µg
EUR 765.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]

VAng-1889Lsx-1mg 1 mg
EUR 4449.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

cDNA Synthesis SuperMix for qPCR

  • EUR 690.00
  • EUR 565.00
  • 0
  • 1
  • Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart

C1236122Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum

C1236130Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney

C1236142Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver

C1236149Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung

C1236152Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung

C1236152Ld-5 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm

C1236169Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas

C1236188Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin

C1236218Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine

C1236226Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord

C1236234Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen

C1236246Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA

HT05-090 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Lung

HA-152 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Skin

HA-218 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Testis

HA-260 10 rxn
EUR 415.00

Total-Transcriptome cDNA Synthesis Kit

G904 25 reactions
EUR 224.00

Total-Transcriptome cDNA Synthesis Kit

G905 100 reactions
EUR 544.00

Mouse iNOS (macrophage) cDNA probe

iNOS61-D-2 2 ug
EUR 445.00

Evo? cDNA Kit (gDNA Removal)

EUR 381.00

Monkey (Rhesus) cDNA Tissue: Thyroid

MR34-265 10 rxn
EUR 415.00

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix

R5101-050 50 rxns
EUR 415.00

amfiRivert cDNA Synthesis Master Mix

R5101-100 2X50 rxns
EUR 847.00

amfiRivert cDNA Synthesis Master Mix

R5101-200 4X50 rxns
EUR 1211.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 500ul
EUR 134.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 2x500ul
EUR 192.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC-Cy7.

Human Leukocyte Immunoglobulin Like Receptor B2 (LILRB2) ELISA Kit

abx251730-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Transcriptome analysis of leaf tissue from Bermudagrass (Cynodondactylon) using a normalised cDNA library


A normalised cDNA library was constructed from Bermudagrass to attain notion into the transcriptome of Cynodondactylon L. A whole of 15 588 high-top quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Evaluation Gene Indices clustering devices to offer a unigene set.


A whole of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation course of was environment friendly. A giant-scale comparative genomic analysis of the unigenes was carried out using publicly obtainable devices, paying homage to BLAST, InterProScan and Gene Ontology. The unigenes have been moreover subjected to a search for EST-derived simple sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), which can be useful as DNA markers.


Although the candidate EST-SSRs and CISPs found inside the present look at must be empirically examined, they’re anticipated to be useful as DNA markers for lots of capabilities, along with comparative genomic analysis of grass species, by benefit of their very important similarities to EST sequences from completely different grasses. Thus, knowledge of Cynodon ESTs will empower turfgrass evaluation by providing homologues for genes that are thought to confer very important options in several crops.


Prolonged-read cDNA Sequencing Permits a ‘Gene-Like’ Transcript Annotation of Transposable Components


  • Transcript-based annotations of genes facilitate every genome-wide analyses and detailed single locus evaluation. In distinction, transposable issue (TE) annotations are rudimentary, consisting of data solely on TE location and kind. The repetitiveness and restricted annotation of TEs prevents the facility to inform aside between doubtlessly helpful expressed elements and degraded copies.


  • To boost genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in quite a lot of layers of TE repression. These uniquely-mapping transcripts have been used to ascertain the set of TEs able to generate polyadenylated RNAs and create a model new transcript-based annotation of TEs that we now have now layered upon the current high-quality neighborhood regular annotation.


  • We used this annotation to chop again the bioinformatic complexity associated to multi-mapping reads from short-read RNA-seq experiments, and we current that this enchancment is expanded in a TE-rich genome paying homage to maize. Our TE annotation moreover permits the testing of explicit standing hypotheses inside the TE self-discipline.


  • We show that incorrect TE splicing does not set off small RNA manufacturing, and the cell further strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work provides a model new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to chop again the bioinformatic complexity associated to repetitive TEs in any organism.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GTPBP8 Polyclonal Antibody
29768-100ul 100ul
EUR 252.00
GTPBP8 Polyclonal Antibody
29768-50ul 50ul
EUR 187.00
GTPBP8 Rabbit pAb
A16189-100ul 100 ul
EUR 308.00
GTPBP8 Rabbit pAb
A16189-200ul 200 ul
EUR 459.00
GTPBP8 Rabbit pAb
A16189-20ul 20 ul
EUR 183.00
GTPBP8 Rabbit pAb
A16189-50ul 50 ul
EUR 223.00
GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
Anti-GTPBP8 antibody
STJ118642 100 µl
EUR 277.00
Rat GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
GTPBP8 Polyclonal Conjugated Antibody
C29768 100ul
EUR 397.00
Human GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
GTPBP8 Recombinant Protein (Human)
RP014239 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014242 100 ug Ask for price
GTPBP8 Recombinant Protein (Rat)
RP203999 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140480 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140483 100 ug Ask for price
Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001 1.0 ug DNA
EUR 506.00
GTPBP8 ORF Vector (Human) (pORF)
ORF004747 1.0 ug DNA
EUR 95.00
GTPBP8 ORF Vector (Human) (pORF)
ORF004748 1.0 ug DNA
EUR 95.00
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828 1.0 ug DNA
EUR 506.00
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829 1.0 ug DNA
EUR 506.00
cDNA Synthesis SuperMix
  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Evo? cDNA Kit
EUR 294.00
Evo? cDNA Kit
EUR 234.00
Novo? cDNA Kit
EUR 354.00
Novo? cDNA Kit
EUR 267.00
Evo? cDNA Supermix
EUR 381.00
Evo? cDNA Supermix
EUR 267.00
Novo? cDNA Supermix
EUR 441.00
Novo? cDNA Supermix
EUR 289.00
Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901 3 x 1.0 ug
EUR 339.00
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501 3 x 1.0 ug
EUR 339.00
GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501 3 x 1.0 ug
EUR 339.00
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106.00
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97.00
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169.00
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97.00
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169.00
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309.00
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445.00
Novo? Transcriptome cDNA Kit
EUR 952.00
Novo? Transcriptome cDNA Kit
EUR 441.00
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504 1.0 ug DNA
EUR 154.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502 1.0 ug DNA
EUR 154.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503 1.0 ug DNA
EUR 154.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504 1.0 ug DNA
EUR 154.00
GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187310 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187311 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187312 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187313 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187314 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187315 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187316 500 ng
EUR 603.00
GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187317 500 ng
EUR 603.00