October 3, 2022

Klkb1 Kalikrein Elisa Kits

Lab Reagents

Human IgG antibody Laboratories manufactures the klkb1 kalikrein elisa kits reagents distributed by Genprice. The Klkb1 Kalikrein Elisa Kits reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact kallikrein elisa. Other Klkb1 products are available in stock. Specificity: Klkb1 Category: Kalikrein Group: Elisa Kits

Elisa Kits information

KLKB1 ELISA KIT|Human

EF005169 96 Tests
EUR 689

KLKB1 ELISA Kit (Human) (OKCD00676)

OKCD00676 96 Wells
EUR 792
Description: Description of target: The enzyme cleaves Lys-Arg and Arg-Ser bonds. It activates, in a reciprocal reaction, factor XII after its binding to a negatively charged surface. It also releases bradykinin from HMW kininogen and may also play a role in the renin-angiotensin system by converting prorenin into renin.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.62 ng/mL

KLKB1 ELISA Kit (Mouse) (OKBB01473)

OKBB01473 96 Wells
EUR 505
Description: Description of target: Plasma kallikrein is a protein that in humans is encoded by the KLKB1 gene. It is mapped to 4q35.2. This gene encodes a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. The encoded preproprotein present in plasma as a non-covalent complex with high molecular weight kininogen undergoes proteolytic processing mediated by activated coagulation factor XII to generate a disulfide-linked, heterodimeric serine protease comprised of heavy and light chains. Certain mutations in this gene cause prekallikrein deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

KLKB1 ELISA Kit (Rat) (OKCA00991)

OKCA00991 96 Wells
EUR 833
Description: Description of target: The enzyme cleaves Lys-Arg and Arg-Ser bonds. It activates, in a reciprocal reaction, factor XII after its binding to a negatively charged surface. It also releases bradykinin from HMW kininogen and may also play a role in the renin-angiotensin system by converting prorenin into renin. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.95 ng/mL

KLKB1 ELISA Kit (Human) (OKEH08687)

OKEH08687 96 Wells
EUR 896
Description: Description of target: This gene encodes a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. The encoded preproprotein present in plasma as a non-covalent complex with high molecular weight kininogen undergoes proteolytic processing mediated by activated coagulation factor XII to generate a disulfide-linked, heterodimeric serine protease comprised of heavy and light chains. Certain mutations in this gene cause prekallikrein deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.235ng/mL

KLKB1 cloning plasmid

CSB-CL012461HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1917
  • Sequence: atgattttattcaagcaagcaacttatttcatttccttgtttgctacagtttcctgtggatgtctgactcaactctatgaaaacgccttcttcagaggtggggatgtagcttccatgtacaccccaaatgcccaatactgccagatgaggtgcacattccacccaaggtgtttgc
  • Show more
Description: A cloning plasmid for the KLKB1 gene.

KLKB1 cloning plasmid

CSB-CL012461HU2-10ug 10ug
EUR 646
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1917
  • Sequence: atgattttattcaagcaagcaacttatttcatttccttgtttgctacagtttcctgtggatgtctgactcaactctatgaaaacgccttcttcagaggtggggatgtagcttccatgtacaccccaaatgcccaatactgccagatgaggtgcacattccacccaaggtgtttgc
  • Show more
Description: A cloning plasmid for the KLKB1 gene.

Anti-KLKB1 antibody

STJ27271 100 µl
EUR 277
Description: This gene encodes a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. The encoded preproprotein present in plasma as a non-covalent complex with high molecular weight kininogen undergoes proteolytic processing mediated by activated coagulation factor XII to generate a disulfide-linked, heterodimeric serine protease comprised of heavy and light chains. Certain mutations in this gene cause prekallikrein deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-KLKB1 antibody

STJ115285 100 µl
EUR 277
Description: This gene encodes a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. The encoded preproprotein present in plasma as a non-covalent complex with high molecular weight kininogen undergoes proteolytic processing mediated by activated coagulation factor XII to generate a disulfide-linked, heterodimeric serine protease comprised of heavy and light chains. Certain mutations in this gene cause prekallikrein deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms.

KLKB1 Rabbit pAb

A13322-100ul 100 ul
EUR 308

KLKB1 Rabbit pAb

A13322-200ul 200 ul
EUR 459

KLKB1 Rabbit pAb

A13322-20ul 20 ul
EUR 183

KLKB1 Rabbit pAb

A13322-50ul 50 ul
EUR 223

Klkb1 Polyclonal Antibody

A62838 100 µg
EUR 570.55
Description: Ask the seller for details

KLKB1 Rabbit pAb

A5318-100ul 100 ul
EUR 308

KLKB1 Rabbit pAb

A5318-200ul 200 ul
EUR 459

KLKB1 Rabbit pAb

A5318-20ul 20 ul
EUR 183