January 24, 2021

Human Tnfrsf13B Elisa Kit

Lab Reagents

Human Elisa Laboratories manufactures the human tnfrsf13b elisa kit reagents distributed by Genprice. The Human Tnfrsf13B Elisa Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Tnfrsf13B Group: Elisa Kit

Elisa Kit information

TNFRSF13B Antibody

1-CSB-PA023971GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNFRSF13B. Recognizes TNFRSF13B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TNFRSF13B siRNA

20-abx937593
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNFRSF13B siRNA

20-abx937594
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

ELISA kit for Mouse TNFRSF13B/TACI

EK5495 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse TNFRSF13B/TACI in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse TNFRSF13B/TACI PicoKine ELISA Kit

EK1144 96 wells
EUR 425
Description: For quantitative detection of mouse TNFRSF13B in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

TNFRSF13B/TACI ELISA Kit (Mouse) (OKBB00514)

OKBB00514 96 Wells
EUR 505
Description: Description of target: Tumor necrosis factor receptor superfamily member 13B, also known as TNFRSF13B or more commonly as TACI, is a transmembrane receptor protein found predominantly on the surface of B cells, which are an important part of the immune system. TACI controls T cell-independent B cell antibody responses, isotype switching, and B cell homeostasis. TACI is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It was originally discovered because of its ability to interact with calcium-modulator and cyclophilin ligand (CAML). TACI was later found to play a crucial role in humoral immunity by interacting with two members of the TNF family: BAFF and APRIL. These proteins signal through TACI inducing activation of several transcription factors including NFAT, AP-1, and NF-kappa-B which then modulate cellular activities. Defects in the function of TACI can lead to immune system diseases.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Human TNFRSF13B shRNA Plasmid

20-abx958305
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNFRSF13B Polyclonal Antibody

30659-100ul 100ul
EUR 252

TNFRSF13B Polyclonal Antibody

30659-50ul 50ul
EUR 187

TNFRSF13B cloning plasmid

CSB-CL023971HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: ATGAGTGGCCTGGGCCGGAGCAGGCGAGGTGGCCGGAGCCGTGTGGACCAGGAGGAGCGCTGGTCACTCAGCTGCCGCAAGGAGCAAGGCAAGTTCTATGACCATCTCCTGAGGGACTGCATCAGCTGTGCCTCCATCTGTGGACAGCACCCTAAGCAATGTGCATACTTCTGTGA
  • Show more
Description: A cloning plasmid for the TNFRSF13B gene.

TNFRSF13B Rabbit pAb

A5658-100ul 100 ul
EUR 308

TNFRSF13B Rabbit pAb

A5658-200ul 200 ul
EUR 459

TNFRSF13B Rabbit pAb

A5658-20ul 20 ul
EUR 183

TNFRSF13B Rabbit pAb

A5658-50ul 50 ul
EUR 223

anti- TNFRSF13B antibody

FNab08825 100µg
EUR 585
  • Immunogen: tumor necrosis factor receptor superfamily, member 13B
  • Uniprot ID: O14836
  • Gene ID: 23495
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against TNFRSF13B

Anti-TNFRSF13B antibody

PAab08825 100 ug
EUR 412