October 3, 2022

Human Satb2 Elisa Kit

Lab Reagents

Human Elisa Laboratories manufactures the human satb2 elisa kit reagents distributed by Genprice. The Human Satb2 Elisa Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Satb2 Group: Elisa Kit

Elisa Kit information

SATB2 Antibody

ABD7929 100 ug
EUR 438

SATB2 Antibody

ABD8002 100 ug
EUR 438

SATB2 Antibody

DF2962 200ul
EUR 304
Description: SATB2 Antibody detects endogenous levels of total SATB2.

SATB2 Antibody

ABD13249 100 ug
EUR 438

SATB2 Antibody

ABD2962 100 ug
EUR 438

SATB2 antibody

10R-1236 50 ug
EUR 242
Description: Mouse monoclonal SATB2 antibody

SATB2 antibody

70R-20092 50 ul
EUR 435
Description: Rabbit polyclonal SATB2 antibody

SATB2 Antibody

4627-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: SATB2 Antibody: Human special AT-rich sequence-binding protein-2 (SATB2) is a nuclear matrix/scaffold-associated region DNA-binding protein. Like its homolog SATB1, SATB2 selectively binds double-stranded, special AT-rich DNA sequences, but is expressed primarily in a subset of postmitotic, differentiating neurons in the neocortex. Mice deficient in SATB exhibit craniofacial abnormalities and defects in osteoblast differentiation and function. SATB2 also interacts with and enhances the activity of Runx2 and ATF4, two transcription factors that regulate osteoblast differentiation, indicating that SATB2 acts as a molecular node in a transcriptional network regulating skeletal development and osteoblast differentiation. Recent experiments have shown that SATB2 interacts with histone deacetylase 1 and metastasis-associated protein 2, two proteins that are involved in chromatin remodeling, suggesting that SATB2 may also be involved in mediating epigenetic influences during cortical development.

SATB2 Antibody

4627-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: SATB2 Antibody: Human special AT-rich sequence-binding protein-2 (SATB2) is a nuclear matrix/scaffold-associated region DNA-binding protein. Like its homolog SATB1, SATB2 selectively binds double-stranded, special AT-rich DNA sequences, but is expressed primarily in a subset of postmitotic, differentiating neurons in the neocortex. Mice deficient in SATB exhibit craniofacial abnormalities and defects in osteoblast differentiation and function. SATB2 also interacts with and enhances the activity of Runx2 and ATF4, two transcription factors that regulate osteoblast differentiation, indicating that SATB2 acts as a molecular node in a transcriptional network regulating skeletal development and osteoblast differentiation. Recent experiments have shown that SATB2 interacts with histone deacetylase 1 and metastasis-associated protein 2, two proteins that are involved in chromatin remodeling, suggesting that SATB2 may also be involved in mediating epigenetic influences during cortical development.

SATB2 Antibody

4629-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: SATB2 Antibody: Human special AT-rich sequence-binding protein-2 (SATB2) is a nuclear matrix/scaffold-associated region DNA-binding protein. Like its homolog SATB1, SATB2 selectively binds double-stranded, special AT-rich DNA sequences, but is expressed primarily in a subset of postmitotic, differentiating neurons in the neocortex. Mice deficient in SATB exhibit craniofacial abnormalities and defects in osteoblast differentiation and function. SATB2 also interacts with and enhances the activity of Runx2 and ATF4, two transcription factors that regulate osteoblast differentiation, indicating that SATB2 acts as a molecular node in a transcriptional network regulating skeletal development and osteoblast differentiation. Recent experiments have shown that SATB2 interacts with histone deacetylase 1 and metastasis-associated protein 2, two proteins that are involved in chromatin remodeling, suggesting that SATB2 may also be involved in mediating epigenetic influences during cortical development.

SATB2 Antibody

4629-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: SATB2 Antibody: Human special AT-rich sequence-binding protein-2 (SATB2) is a nuclear matrix/scaffold-associated region DNA-binding protein. Like its homolog SATB1, SATB2 selectively binds double-stranded, special AT-rich DNA sequences, but is expressed primarily in a subset of postmitotic, differentiating neurons in the neocortex. Mice deficient in SATB exhibit craniofacial abnormalities and defects in osteoblast differentiation and function. SATB2 also interacts with and enhances the activity of Runx2 and ATF4, two transcription factors that regulate osteoblast differentiation, indicating that SATB2 acts as a molecular node in a transcriptional network regulating skeletal development and osteoblast differentiation. Recent experiments have shown that SATB2 interacts with histone deacetylase 1 and metastasis-associated protein 2, two proteins that are involved in chromatin remodeling, suggesting that SATB2 may also be involved in mediating epigenetic influences during cortical development.

SATB2 Peptide

4627P 0.05 mg
EUR 164.75
Description: (NT) SATB2 peptide

SATB2 Peptide

4629P 0.05 mg
EUR 164.75
Description: (CT) SATB2 peptide

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human SATB2 shRNA Plasmid

20-abx958173
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SATB2 Recombinant Protein (Human)

RP043099 100 ug Ask for price

SATB2 cloning plasmid

CSB-CL892170HU-10ug 10ug
EUR 726
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2202
  • Sequence: ATGGAGCGGCGGAGCGAGAGCCCGTGTCTGCGGGACAGCCCCGACCGGCGGAGCGGCAGCCCGGACGTCAAGGGGCCTCCCCCAGTGAAGGTGGCCCGGCTGGAGCAGAACGGCAGCCCCATGGGAGCCCGCGGGAGGCCCAACGGCGCCGTGGCCAAGGCCGTGGGAGGTTTGA
  • Show more
Description: A cloning plasmid for the SATB2 gene.