October 3, 2022

Human Sall4 Elisa Kit

Lab Reagents

Human Elisa Laboratories manufactures the human sall4 elisa kit reagents distributed by Genprice. The Human Sall4 Elisa Kit reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Human products are available in stock. Specificity: Human Category: Sall4 Group: Elisa Kit

Elisa Kit information

Sall4 Antibody

DF7757 200ul
EUR 304
Description: Sall4 Antibody detects endogenous levels of total Sall4.

anti-SALL4

YF-PA26465 50 ul
EUR 334
Description: Mouse polyclonal to SALL4

SALL4 Peptide

46-333P 0.1 mg
EUR 338
Description: Sall4 Peptide

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human SALL4 shRNA Plasmid

20-abx961370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Sal-like protein 4(SALL4) ELISA kit

CSB-EL020676HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4 (SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Sal-like protein 4(SALL4) ELISA kit

1-CSB-EL020676HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Sal-like protein 4(SALL4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Sal-Like Protein 4 (SALL4) ELISA Kit

20-abx383011
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Sal- like protein 4, SALL4 ELISA KIT

ELI-29742h 96 Tests
EUR 824

SALL4 cloning plasmid

CSB-CL892126HU-10ug 10ug
EUR 1164
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3162
  • Sequence: ATGTCGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGCAGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGGAGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGG
  • Show more
Description: A cloning plasmid for the SALL4 gene.

SALL4 Polyclonal Antibody

ES11394-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SALL4 Polyclonal Antibody

ES11394-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SALL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SALL4 antibody

STJ29204 100 µl
EUR 277
Description: This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-SALL4 antibody

STJ118646 100 µl
EUR 277

Anti-SALL4 antibody

STJ192552 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SALL4

Anti-SALL4 antibody

STJ160131 1 mL C
EUR 544

Anti-SALL4 antibody

STJ180237 0.1 ml
EUR 244