January 17, 2021

Ahnak2 Human Elisa Kits

Lab Reagents

Human Elisa Laboratories manufactures the ahnak2 human elisa kits reagents distributed by Genprice. The Ahnak2 Human Elisa Kits reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Ahnak2 products are available in stock. Specificity: Ahnak2 Category: Human Group: Elisa Kits

Elisa Kits information

AHNAK2 Recombinant Protein (Human)

RP000817 100 ug Ask for price

AHNAK2 Blocking Peptide

33R-1056 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPAL2 antibody, catalog no. 70R-6454

AHNAK2 cloning plasmid

CSB-CL812872HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1452
  • Sequence: atgaggcttccagaaacccaggttcttccaggagaaatagatgagactcctctttccaagccaggacatgaccttgccagcatggaggataaaacagagaaatggtcttcccagcctgaaggtccacttaaattgaaagcttcaagtactgatatgccatcccagatttctgtgg
  • Show more
Description: A cloning plasmid for the AHNAK2 gene.

AHNAK2 Polyclonal Antibody

A70007 100 ?g
EUR 628.55
Description: reagents widely cited

pCMV-SPORT6-AHNAK2

PVT19075 2 ug
EUR 231

Anti-AHNAK2 (4G9)

YF-MA19715 100 ug
EUR 363
Description: Mouse monoclonal to AHNAK2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Basic Cytotoxicity Test Kits

CT17001 125 Tests
EUR 409

Basic Cytotoxicity Test Kits

CT17002 250 Tests
EUR 650

Total Cytotoxicity Test Kits

CT17003 125 Tests
EUR 513

Total Cytotoxicity Test Kits

CT17004 250 Tests
EUR 813

T&A Cloning Kits

FYC001-20P 1 vial Ask for price

Necrosis vs Apoptosis Kits

KF17371 50-100 Tests
EUR 435

Necrosis vs Apoptosis Kits

KF17372 100-200 Tests
EUR 768

Pipette Stand Starter Kits

P7700-S1 1 PC
EUR 507.83
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Pipette Stand Starter Kits

P7700-S2 1 PC
EUR 526.1
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Human AHNAK Nucleoprotein 2(AHNAK2)ELISA Kit

QY-E05162 96T
EUR 400