Lab Reagents
Human Elisa Laboratories manufactures the ahnak2 human elisa kits reagents distributed by Genprice. The Ahnak2 Human Elisa Kits reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Human elisa. Other Ahnak2 products are available in stock. Specificity: Ahnak2 Category: Human Group: Elisa Kits
Elisa Kits information
AHNAK2 Recombinant Protein (Human) |
|
RP000817 |
ABM |
100 ug |
Ask for price |
AHNAK2 Blocking Peptide |
|
33R-1056 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPAL2 antibody, catalog no. 70R-6454 |
AHNAK2 cloning plasmid |
|
CSB-CL812872HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1452
- Sequence: atgaggcttccagaaacccaggttcttccaggagaaatagatgagactcctctttccaagccaggacatgaccttgccagcatggaggataaaacagagaaatggtcttcccagcctgaaggtccacttaaattgaaagcttcaagtactgatatgccatcccagatttctgtgg
- Show more
|
|
Description: A cloning plasmid for the AHNAK2 gene. |
AHNAK2 Polyclonal Antibody |
|
A70007 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
Anti-AHNAK2 (4G9) |
|
YF-MA19715 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to AHNAK2 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Basic Cytotoxicity Test Kits |
|
CT17001 |
Neuromics |
125 Tests |
EUR 409 |
Basic Cytotoxicity Test Kits |
|
CT17002 |
Neuromics |
250 Tests |
EUR 650 |
Total Cytotoxicity Test Kits |
|
CT17003 |
Neuromics |
125 Tests |
EUR 513 |
Total Cytotoxicity Test Kits |
|
CT17004 |
Neuromics |
250 Tests |
EUR 813 |
Necrosis vs Apoptosis Kits |
|
KF17371 |
Neuromics |
50-100 Tests |
EUR 435 |
Necrosis vs Apoptosis Kits |
|
KF17372 |
Neuromics |
100-200 Tests |
EUR 768 |
Pipette Stand Starter Kits |
|
P7700-S1 |
BenchMark |
1 PC |
EUR 507.83 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Pipette Stand Starter Kits |
|
P7700-S2 |
BenchMark |
1 PC |
EUR 526.1 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
